Explore

Advertise on Engormix

Pig transportation as a key for dissemination and maintenance of porcine epidemic diarrhea virus infection in Colombia

Published: December 22, 2025
Source : D. S. Vargas Bermudez 1*, G. Ramirez 1, V. Vera 1, J. Jaime 1 / 1 Group of Microbiology and Epidemiology, Universidad Nacional de Colombia, Bogota, Colombia.
Summary

Keywords: enviromental samples, qPCR, trucks

Introduction:
Porcine epidemic diarrhea virus (PEDV) is a devastating enteric disease. In Colombia, PEDV was first reported in two departments in early 2014. The goal of this research was to evaluate PEDV presence on porcine transportation trucks from 14 different regions of Colombia as a contributing factor to the spread and maintenance of the disease in Colombia.
Materials and Methods:
Environmental samples were collected from 520 trucks employed to transport live pigs destined for slaughterhouses. The samples were taken at two moments: upon arrival and after unloading from the abattoir (when trucks were disinfected). Samples were collected from June to October of 2014. The study included 32 abattoirs from 14 Colombian departments. Sample collection consisted of rubbing a PBS moistened pad (3M®) on the inner floor of the truck. RNA extraction was performed with the RNeasy® QIAGEN kit, first stand cDNA was synthetized by using the reverse transcription High Capacity cDNA synthesis Applied Biosystems® Kit and real time PCR was performed on a conserved region of the nucleocapside (N) gene, employing LightCycler® 480 probes Master-Roche mix. Primers and probes targeting the gene sequence were: forward, 5’GAATTCCCAAGGGCGAAAAT3’, reverse 5’TTTTCGACAAATTCCGCATCT3’, and probe FAM-CGTAGCAGCTTGCTTCGGACCCA-BHQ. All positive samples for gene N were re-checked for amplification of genes S (spike) and M. Samples were processed at the Laboratory of Animal Virology of the Universidad Nacional de Colombia, Bogotá D.C.
Results:
In total, 483 of 520 trucks (92.8%) were contaminated upon arrival and 468/520 trucks remained contaminated after unloading. Only 7% of the trucks were not contaminated with PEDV upon arrival from the abbatoir. Samples from positive trucks showed the same cycle threshold values at arrival and departure. We found high viral loads of PEDV in departments where swine production is highest, such as Cundinamarca, Valle del Cauca, and Antioquia, with a Ct value rate of 32. At the beginning of the study (June and July), Ct values were lower compared to September and October (30.5 versus 36, respectively). We found PEDV in 8/14 departments (57%) and 17/32 slaughterhouses (53%). Finally, this study showed that 57% of the positive samples had Ct values between 30 and 35, which correspond to low viral loads (1x104 copies).
Conclusion:
We confirmed the presence and spread of PEDV in different departments of Colombia. This study suggests that trucks can be an efficient source of dissemination of PEDV between farms and departments. The low viral load found in the majority of the samples shows that although the virus is circulating in Colombia, it is not showing fatal signs of illness.
Disclosure of Interest: None Declared.
    
Published in the proceedings of the International Pig Veterinary Society Congress – IPVS2016. For information on the event, past and future editions, check out https://www.theipvs.com/future-congresses/.
Content from the event:
Related topics:
Recommend
Comment
Share
Profile picture
Would you like to discuss another topic? Create a new post to engage with experts in the community.
Featured users in Pig Industry
Chris Parks
Chris Parks
Cargill
Cargill
United States
Neil Ferguson
Neil Ferguson
Trouw Nutrition
Asesor Técnico
United States
Erika Gisela Lin-Hendel
Erika Gisela Lin-Hendel
dsm-Firmenich
United States