Effect of beta-lactoglobulin polymorphism and seasonality on bovine milk composition

Published on: 05/09/2012
Author/s : Bruno G Botaro (University of Sao Paulo), Ygor V R Lima (Centro Universitario Anhangüera), Adriana A Aquino (Universidade Federal de Lavra), Raquel H R Fernandes (Universidade de Sao Paulo),Jose F Garcia (Universidade Estadual Paulista Julio de Mesquita Filho) and Marcos V Santos (University of Sao Paulo)
(408)
(0)
(1)
(0)

The objective was to evaluate the effect of β-lactoglobulin ( β -lg) polymorphism and seasonality on milk composition" style="font-size:inherit;font-weight:inherit;font-family:inherit;text-decoration:inherit;">milk composition (fat, lactose, total solids, milk urea nitrogen, total protein, true protein, casein and somatic cell counts) of Holstein and Girolando cows. Milk and blood samples from 278 Holsteins cows and 156 Girolando cows were taken during two dry seasons and two rainy seasons, for milk composition analysis and to determine  β -lg genotypes, respectively. BB genotype was the most frequent for both breeds, followed by AA genotype for Holstein (BB>AA>AB) and by AB for Girolando cows (BB>AB>AA). No differences were found in milk compositional characteristics among genetic variants of  β -lg (AA, AB and BB) either between Holstein or Girolando cows. No association between milk composition and b-lg genetic polymorphism was observed. During the dry season, independently of the breed considered, higher contents of lactose, true protein, casein and casein:true protein ratio were found.

Keywords: Milk protein,  β -lactoglobulin, genetic variants, seasonality.

The discovery of electrophoretically distinct types of  β -lactoglobulin ( β -lg) by Aschaffenburg & Drewry (1955) initiated the beginning of extensive investigations of the different genotypes of this whey protein (Hambling et al. 1992). The two main genetic forms of β-lg differ in the substitution of a Gly and an Ala in the B variant, for an Asp and a Val in the A variant (Ghashghaei, 2003) and this slight molecular difference has been widely associated with significant differences in milk composition in dairy cows (Dove, 2000).

Several studies have reported the association of significantly higher fat content (Ng Kwai-Hang et al. 1986; Aleandri et al. 1990; Tsiaras et al. 2005), protein (Litwinczuketal. 2006),casein (Robitailleetal. 2002), true protein (Bobe et al. 1999) and total solids (Celik, 2003) with BB variant, while others have found higher milk component concentrations due to the AA variant (Ng Kwai-Hang et al. 2002b; Robitaille et al. 2002; Molina et al. 2006). Nonetheless, some authors have found no relationship between  β -lg polymorphism and milk composition, and attributed the differences observed in fat and protein contents to other factors (Ng Kwai-Hang et al. 2002a).

Factors other than genetic polymorphism of milk proteins, e.g., seasonal variations (Paquin & Lacroix, 1994; Carlsson et al. 1995; Lacroix et al. 1996; Allore et al. 1997; Auldist et al. 1998; Sharma et al. 2002; LindmarkMa¨nsson et al. 2003; Teixeira et al. 2003; Amenu et al. 2006) and breed (Auldist et al. 1998; Arunvipas et al. 2003) all affect milk composition but their interaction with  β-lg genetic variants has not been studied. Moreover, data on the association between  β-lg genetic variants of Girolando cows and milk composition of this breed are still rare. The Girolando breed is basically the result of crossing between the Holstein and Gir (indigenous Zebu breed) in standard proportions of 3/8 Zebu and 5/8 Taurine. This crossbred breed is very common in Brazil because it is claimed to have both the high resistance to heat and humidity characteristic of Indian cattle and the high productivity characteristic of European cattle (Bicalho etal.2006). The objective of this study was to evaluate the effect of genetic polymorphism of  β -lg on milk composition (fat, lactose, total solids, milk urea nitrogen, total protein, true protein, casein and somatic cell counts) in Holstein and Girolando cows, during dry and rainy seasons.

Material and Methods

Selection of herds and cows for sampling

The study was carried out in eleven commercial dairy herds in the state of Sao Paulo, Brazil; among them six were composed of Girolando (crossbred Holstein-Zebu) and five of Holstein cows. Milk and blood samples were taken from 278 lactating Holstein cows and 156 lactating Girolando cows during two dry seasons and two rainy seasons (Sampling period 1, September and October, 2003; Sampling period 2, June and July, 2004; Sampling period 3, November and December, 2004; and Sampling period 4, January and February, 2005). In each dairy herd, the sampled cows had to fulfil the following criteria: first–third lactation and 30–250d of lactation. Cows with clinical mastitis, or submitted to mastitis treatment 2 weeks before milk sampling, were excluded from this study. In addition, at the time of milk sampling, information such as age, days in lactation and type of feeding system (pasture, supplemented pasture or total mixed ration) for each selected dairy cow was registered.

Milk samples were collected during morning milking in order to represent the whole milking of each animal. The individual samples were collected directly from the collection bucket immediately after milking, or during milking, using flux measurement devices connected to the milk line. Collected samples were split into two flasks: one treated with Bronopol (Boots Microcheck, Nottingham, UK) was used for fat, lactose, total solids, milk urea nitrogen and somatic cell determinations; and the other was used for analysis of milk protein fractions.

Methods of analysis

Milk composition: Milk samples were analysed for fat, lactose and total solids by infrared absorption methodology (Bentley 2000, Bentley, Chasca MN, USA). Milk urea nitrogen (MUN) was determined by the colorimetric enzymic method (Chemspec 150, Bentley Instruments Inc., Chasca MN, USA). Somatic cells were electronically counted (Somacount 300, Bentley Instruments Inc.) and converted to log scale (LogSCC). Milk protein fractions were determined for total nitrogen (AOAC, 1990; method 33.2.11; 991.20), non-casein nitrogen (NCN) (Lynch et al. 1998) and non-protein nitrogen (NPN) (AOAC, 1995; method 33.2.12; 991.21). In order to express the results as total protein (TP), total nitrogen values found were multiplied by 6.38 (Barbano et al. 1990). Milk true protein (MTP) and casein concentrations were obtained by difference according to: TP–(NPNr6.38)=milk true protein, and MTP–(NNCr6.38)=casein, respectively.

β-lg genetic polymorphism analysis: After DNA extraction from blood samples according to Ciulla et al. (1988), extracted DNA samples were submitted to PCR amplification as described by Schlee & Rottmann (1992). The oligonucleotides primers used for DNA amplification were synthesized by Invitrogen Custom Primers (Inivitrogen Corp., Carlsbad CA 92008, USA), according to the sequence described by Faria et al. (2000):

Forward: 5´ACCTGGAGATCCTGCTGCAGAAATG3´

Reverse: 5´CATCGATCTTGAACACCGCAGGGAT3´

Each amplification reaction consisted of PCR buffer 1X (500mM-KCl, 100mM-Tris–Cl pH8.3), 0.1μl of the described primers, 2.0 μl dNTP (0.125mM), 0.1 μl Taq polymerase (Cenbiot/RS, PHN/MG), 0.75 μl MgCl 2 (Cenbiot/ RS, PHN/MG), 5.0 μl of DNA and mili-Q water qsp 25 μl. In all amplified reactions, a control (blank/no-DNA) was used to confirm the absence of contamination during the analysis. The amplification process was carried on a PTC 100-MJ Research thermocycler (MJ Research Inc., Watertown MA 02472, USA).

After DNA amplification of the targetted fragment, a 961-bp region of the  β -lg gene, the PCR product (2 μl ) was submitted to RFLP in a 2% agarose gel electrophoresis, and digested by the restriction enzyme Hph-I (Invitrogen Corp.) according to Wilkins & Kuys (1992) to show the presence of either AA, AB or BB genotypes. Hph-I cleaved amplified fragments in 741 and 220bp (AA genotype), 741, 166 and 54bp (BB genotype), or a combination of both (AB genotype), with 741, 220, 166 and 54bp (Wilkins & Kuys, 1992). After  β-lg gene identification, the genotype and allele frequencies for the studied herd were obtained.

Statistical analysis

Effects of β-lg, breed and seasonality were analysed in a randomized block design with number of lactation (1, 2 and o3) and feeding system (pasture, supplemented pasture or total mixed ration) as blocks. For statistical analysis, selected cows were distributed according to the  β -lg genetic variant (AA, AB or BB), breed (Holstein or Girolando) and seasonality (dry or rainy season). Descriptive statistics of the given results were stored (arithmetic mean and SEM) and analysis of variance was performed, evaluating the effects of breed, seasonality and genetic variation ofb-lg on the response variables, by the SAS PROC GLM procedure (Statistical Analysis System, Version 8.02; SAS Institute Inc., Cary NC 2001, USA).

In the adopted model, dependent variables used were milk composition (MC) characteristics and fixed factors were  β -lg polymorphism, breed and seasonality. The MC is the variable considered for milk composition; m= mean value for the characteristic; Li=lactation number (i=1, 2 ando3), Fj=feeding system (j=pasture, supplemented pasture or total mixed ration), Bl=Breed (l= Holstein and Girolando); Pm=genotypes (m=AA, AB and BB); Sn=seasonality (n=rainy and dry season); eijlmnp= error.

Table 1.  β -lactoglobulin gene and allele frequencies for Holstein and Girolando cows

Results

Genetic polymorphism of β-lg in Holstein and Girolando cows

A total of 278 Holstein and 156 Girolando cows were tested for genetic polymorphism of β-lg. The distribution of genotype and allele frequencies for the  β -lg gene of Holstein and Girolando cows, obtained by PCR-RFLP, is summarized in Table 1.

All three β -lg genotypes (AA, AB and BB) were present in both breeds. The allele B was present in a higher frequency both for Holstein and Girolando breed (0.5305± 0.021 and 0.6185±0.027, respectively). The frequency of appearance of genotypes differed between Holstein and Girolando cows. BB genotype was the most frequent (38.85% and 44.87%) among studied breeds. AA and AB genotypes had frequencies of 32.73% and 28.42% for Holstein, but 21.15% and 33.97% for Girolando cows.

Effect of β-lg genetic polymorphism and breed on milk composition

Milk composition mean values and SEM for β-lg genotypes in Holstein and Girolando cows are shown in Table 2.

No statistical differences in milk composition of both breeds were observed among  β -lg genotypes for any of the studied variables except for milk urea nitrogen concentration, which was higher (16.64mg/dl) for Holstein than for Girolando cows (14.38mg/dl). No interaction between β-lg and breed was found for milk composition.

The average of milk fat and total solids content for the AA, AB and BB genotypes did not differ in any of the breeds. For Holstein cows, milk fat averages were 3.305, 3.267 and 3.359% for the AA, AB and BB genotypes, respectively, while for Girolando, the averages were 3.143, 3.274 and 3.166% for the same genotypes. Total solids averages 11.824, 11.823 and 11.876% among Holstein cows of AA, AB and BB genotypes, respectively, and 11.595, 11.808 and 11.755%, respectively to the cited genotypes for Girolando animals.

Concentrations of total protein, true protein, casein, MUN as well the casein:true protein ratio were not influenced by the β-lg genotypes in this study. Milk from Holstein and Girolando BB cows, respectively, had total protein of 3.125 and 3.091%, true protein of 2.892 and 2.859%, and casein of 2.095 and 2.070%. Averages for the casein:true protein ratio among BB genotype cows were 0.722 for the Holstein breed and 0.721 for Girolando.

Effect of β-lg genetic polymorphism and seasonality on milk composition

Effects of seasonality and  β -lg polymorphism on milk composition are shown on Table 3.

Concentrations of lactose, MTP, casein and casein:MTP ratio were significantly higher during the dry season than in the rainy season. Average concentrations for the dry season were 4.501, 2.918 and 2.132g/100g of milk, respectively for lactose, TP, MTP and casein, while rainy season corresponding means were 4.349, 2.846 and 1.994g/100g of milk. No interaction between seasonality and  β -lg polymorphism was observed.

When non-significant interactions were removed from the statistical model, casein concentrations observed during the rainy season were different among  β -lg genetic variants (AA>BB) with higher averages for AA (2.067g/ 100g of milk) compared with BB cows (1.949g/100g of milk). But no differences were observed for milk composition variables among  β -lg variants within the dry season.

Discussion

Ng Kwai-Hang et al. (1986), Van Eenennaam & Medrano, (1991), Celik (2003), Oner & Elmaci (2006) reported higher frequencies for the B allele for Holstein cows. In the present study, the frequency of genotype appearance differed between Holstein and Girolando cows. Although the BB genotype was the most frequent for both breeds (38.85% and 44.87%), AA genotype was the second higher in frequency level in Holstein breed (BB>AA>AB), while the AB was more frequent than AA genotype in Girolando cows (BB>AB>AA). Higher levels of BB genotype frequencies among Holstein cows were also observed by Celik (2003) but not by Hill (1993) and Oner & Elmaci (2006), who found a higher number of the heterozygous AB variants compared with homozygous cows.

Table 2. Effect of β-lactoglobulin polymorphism in Holstein and Girolando cows on milk composition

 

 

 

 

 

 

 

 

 

 

 

 

Table 3. Effect of seasonality and β-lactoglobulin polymorphism on milk composition

 

 

 

 

 

 

 

 

 

 

 

Nevertheless, no report on  β -lg genetic variants in Girolando animals was found in the literature, and data on  β -lg allele frequency among Bos indicus breeds show a higher prevalence for the B gene (Silva& Del Lama,1997; Neves et al. 1998; Faria et al. 2000) and a higher frequency for the BB genotype.

The present results differ from those of Ng Kwai-Hang etal.(1986), Aleandrietal.(1990),Bovenhuisetal.(1992) and Hill (1993). These authors all reported higher milk fat concentration in milk of Holstein cows comprising B variants of β-lg, and Hill (1993) concurred for significantly lower concentrations of fat and total solids in AA Holstein milk.

Milk nitrogen fractions were not influenced by  β -lg genetic polymorphism in any of the breeds, although TP, MTP, casein means and casein:MTP ratio for AA cows were numerically higher for bothbreeds. Similarly, Molina etal.(2006) and Bobe et al. (1999) found an increase in TP concentrations of milk when Ballele was substituted for A. According to Bobe et al. (1999) such increment is due to the higher percentage of casein in  β -lg A milk, while Molina et al. (2006) attributed this increase to the higher content of whey protein in milk with A variants. Mean values for casein and MTP concentrations in the present study, however, seem to be in disagreement with Robitaille et al. (2002), who found a tendency for higher casein concentrations in BB β-lg milk in Holsteins, and with a report of increased MTP when B allele was more frequent in the Holstein breed (Ng Kwai-Hang, Monardes & Hayes, 1990).

Although not statistically significant, the casein: MTP ratios for AA milk of both breeds were slightly higher than those observed for either AB or BB genotypes, and this is particularly relevant as MTP, especially  β -lg concentrations in milk true protein, plays an important role in milk stability during heat treatment, since this protein strongly interacts with other milk molecules, particularly k-casein (Karatzas & Turner, 1997; Fox & McSweeney, 1998; Singh, 2004).

MUN concentrations the present study ranged from 12 to 18mg/dl within the normal minimum and maximum limits for lactating Holstein cows (Meyer et al. 2004). Higher MUN was observed for Holstein cows, but no effect of season and β-lg polymorphism was found. According to Arunvipas et al. (2003), effects of non-nutritional factors on MUN, such as breed, stage of lactation and cow pregnancy, production and milk composition explain 13.3% of the variability of MUN concentrations.

Based on the results of this study, there was no association between milk composition (fat, lactose, total solids, TP, MTP, casein, casein:MTP ratio, somatic cell count and MUN) and β-lg genetic variant itself. During the dry season, independently of breed considered, higher contents of lactose, TP, MTP, casein and casein:MTP ratio were found.

The authors thank the Fundacao de Amparo a Pesquisa do Estado de Sao Paulo for the financial support to conduct this study (Grant n8 02/12058-9), and Jose´ Franchini Garcia Moreno and Lucine´ia Mestieri, for their technical assistance.

References

Aleandri R, Buttazzoni LG, Schneider JC, Caroli A & Davoli R 1990 The effects of milk protein polymorphisms on milk components and cheese producing ability. Journal of Dairy Science 73 241–255

Allore HG, Oltenacu PA & Erb HN 1997 Effects of season, herd size, and geographic region on the composition and quality of milk in the northeast. Journal of Dairy Science 80 3040–3049

Amenu B, Cowan T, Deeth H & Moss R 2006 Impacts of feeding system and season on milk composition and cheddar cheese yield in a subtropical environment. Australian Journal of Experimental Agriculture 46 299–306

AOAC 1995 Official Methods of Analysis 16th Edn Arlington VA, USA: Association of Official Analytical Chemists

AOAC 1990 Official Methods of Analysis 15th Edn Arlington VA, USA: Association of Official Analytical Chemists

Arunvipas P, Dohoo IR, Van Leeuwen JA & Keefe GP 2003 The effect of non-nutritional factors on milk urea nitrogen levels in dairy cows in Prince Edward Island, Canada. Preventive Veterinary Medicine 59 83–93

Aschaffenburg R & Drewry J 1955 Occurrence of different  β -lactoglobul in in cow´s milk. Nature 176 218–219

Auldist MJ, Walsh BJ & Thomson NA 1998 Seasonal and lactational influences on bovine milk composition in NewZealand. Journal of Dairy Research 65 401–411

Barbano DM, Clark JL, Dunham CE & Fleming JR 1990 Kjeldahl method for determination of total nitrogen content of milk: Collaborative study. Journal of the Association of Official Analytical Chemists 73 849–859

Bicalho HMS, Pimenta CG, Mendes IKP, Pena HB, Queiroz EM & Pena SDJ 2006 Determination of ancestral proportions in synthetic bovine breeds using commonly employed microsatellite markers. Genetics and Molecular Research 5 432–437

BobeG, Beitz DC, Freeman AE& Lindberg GL 1999 Effect of milk protein genotypes on milk protein composition and its genetic parameter estimates. Journal of Dairy Science 82 2797–2804

Bovenhuis H, Arendonk JAM & Korver S 1992 Associations between milk protein polymorphisms and milk production traits. Journal of Dairy Science 75 2549–2559

Carlsson J, Bergstrom J & Pehrson B 1995 Variations with breed, age, season, yield, stage of lactation and herd in the concentration of urea in bulk milk and in individual cows milk. Acta Veterinaria Scandinavica 36 245–254

Celik S 2003  β -lactoglobul in genetic variants in Brown Swiss breed and its association with compositional properties and rennet clotting time of milk. International Dairy Journal 13 727–731

Ciulla TA, Sklar RM & Hauser SL 1988 A simple method for DNA purification from peripheral blood. Analytical Biochemistry 174 485–488

Dove P 2000 Genetic polymorphisms in milk protein genes and their impact on milk composition. In: Biology of the Mammary Gland: Advances in Experimental Medicine and Biology 225–230 (Eds JA Mol & RA Clegg). New York NY, USA: Kluwer Academic/Plenum Publishers

Faria FJC, Guimara˜es SEF, Moura˜o GB, Lima RMG & Pinheiro LEL 2000 [Polymorphism analysis of β-lactoglobulin gene in Nellore cows and effects on weaning weight of the calves[. Arquivo Brasileiro de Medicina Veterina´ria e Zootecnia 52 261–265

Fox PF & McSweenwey PLH 1998 Dairy Chemistry and Biochemistry. London: Blackie Academic & Professional.

Ghashghaei K 2003 Effect of cow phenotype and milk protein structure on biofouling rates in heat exchangers. MS thesis presented to the Faculty of California Polytechnic State University, San Luis Obispo, 98 p.

Hambling SG, McAlpine AS & Sawyer L 1992  β -lactoglobulin. In Advanced Dairy Chemistry, Vol. 1: Proteins, 2nd Edn (Ed. PF Fox) pp. 141–189. London, Elsevier Applied Science.

Hill JP 1993 The relationship betweenb-lactoglobulin phenotypes and milk composition in New Zealand dairy cattle. Journal of Dairy Science 76 281–286

Karatzas CN & Turner JD 1997 Toward altering milk composition by genetic manipulation: Current status and challenges. Journal of Dairy Science 80 2225–2232

Lacroix C, Verret P & Paquin P 1996 Regional and seasonal variations of nitrogen fractions in commingled milk. International Dairy Journal 6 947–961

Lindmark-Ma¨nsson H, Fonden R & Pettersson H 2003 Composition of Swedish dairy milk. International Dairy Journal 13 409–425

Litwinczuk A, Barlowska J, Krol J & Litwinczuk Z 2006 Milk protein polymorphism as markers of production traits in dairy and meat cattle. Medycyna Weterynaryjna 62 6–10

Lynch JM, Barbano DM & Fleming JR 1998 Indirect and direct determination of the casein content of milk by Kjeldahl nitrogen analysis: Collaborative study. Journal of the Association of Official Analytical Chemists 81 763–774

Meyer PM, Machado PF, Coldebella A, Corassin CH, Cassoli LD, Coelho KO & Rodrigues PHM 2004 Development of models to estimate milk urea nitrogen concentrations. Journal of Animal and Feed Sciences 13 527–530

Molina LH, Kramm J, Brito C, Carrillo B, Pinto M & Ferrando A 2006 Protein composition of milk from Holstein-Friesian dairy cows and its relationship with the genetic variants A and B of kappa-casein and  β -lactoglobulin (part I). International Journal of Dairy Technology 59 183–187

Neves ALG, Guimara˜es SEF, Lima RMG, Penna VM & Pinheiro LEL 1998 [Identification of A and B variants of the b-lactoglobulin gene in Brazilian Gir populations] Arquivo Brasileiro de Medicina Veterina´ria e Zootecnia 50 409–414

Ng Kwai-Hang KF, Dodds C, Boland MJ & Auldist MJ 2002a The influence of genetic variants of  β -lactoglobulin on gelation speed and firmness of rennet curd. Milchwissenschaft 57 267–269

Ng Kwai-Hang KF, Hayes JF, Moxley JE & Monardes HG 1986 Relationships between milk protein polymorphism´s and major milk constituents in Holstein-Friesian cows. Journal of Dairy Science 69 22–26

Ng Kwai-Hang KF, Monardes HG & Hayes JF 1990 Association between genetic polymorphism of milk proteins and production traits during three lactations. Journal of Dairy Science 73 3414–3420

Ng Kwai-Hang KF, Otter DE, Lowe E, Boland MJ & Auldist MJ 2002b Influence of genetic variants ofb-lactoglobulin on milk composition and size of casein micelles. Milchwissenschaft 57 303–306

Oner Y & Elmaci C 2006 Milk protein polymorphisms in Holstein cattle. International Journal of Dairy Technology 59 180–182

Paquin P & Lacroix C 1994 Seasonal and regional variations of different milk protein fractions: A survey of Quebec milk. In Protein Definition pp. 3–39. Brussels, Belgium: International Dairy Federation

Robitaille G, Britten M, Morisset J & Petitclerc D 2002 Quantitative analysis of β-lactoglobulin A and B genetic variants in milk of cows  β -lactoglobulin AB throughout lactation. Journal of Dairy Research 69 651–654

Schlee P & Rottmann O 1992 Genotyping of bovine beta-casein,  β -lactoglobulin and alpha-lactalbumin using the polymerase chain reaction. Journal of Animal Breeding and Genetics 109 456–464

Sharma RB, Kumar M & Pathak V 2002 Effect of different seasons on crossbred cow milk composition and paneer yield in subHimalayan region. Asian-Australasian Journal of Animal Sciences 15 528–530

Silva IT & Del Lama MA 1997 Milk protein polymorphisms in Brazilian zebu cattle. Brazilian Journal of Genetics 20 625–630

Singh H 2004 Heat stability of milk. International Journal of Dairy Technology 57 111–119

Teixeira NM, Freitas AF & Barra RB 2003 [Environmental factors influencing monthly variation of milk composition and somatic cell counts in herds of the State of Minas] Gerais Arquivo Brasileiro de Medicina Veterina´ria e Zootecnia 55 491–499

Tsiaras AM, Bargouli GG, Banos G & Boscos CM 2005 Effect of kappacasein andb-lactoglobulin loci on milk production traits and reproductive performance of Holstein cows. Journal of Dairy Science 88 327–334

Van Eenennaam A & Medrano JF 1991 Milk protein polymorphisms in California dairy cattle. Journal of Dairy Science 74 1730–1742

Wilkins RJ & Kuys YM 1992 Rapid β-lactoglobulin genotyping of cattle using the polymerase chain reaction. Animal Genetics 23 175–178

This article was originally published on Journal of Dairy Research, 2008 75 176–181.

(408)
(0)
(1)
(0)





Would you like to discuss about this topic: Effect of beta-lactoglobulin polymorphism and seasonality on bovine milk composition?
Engormix.com reserves the right to delete and/or modify comments. See more details

Comments that contain the following items won´t be published:

  • Repeated spelling mistakes.
  • Advertisements, Web sites and/or e-mail addresses.
  • Questions or answers not relevant to the topic discussed in the Forum.
ABSTRACT The present research was conducted to determine effects of high tem...
 
There is little doubt that raw milk is the most scrutinized agricultural commod...
Forums (39)
the lacteal secretions are suppressed due the use of steroid in cattle and buffa...
 
Excellent article emphasized the importance of nutrition,association with milk c...
Professional Services
Brian Sievert Brian Sievert
Sioux Falls, South Dakota, United States
Mike officer Mike officer
Weldon Spring Heights, Missouri, United States of America
Robert G. Kennedy Robert G. Kennedy
Kingsburg, California, Estados Unidos de América
Francisco Gomez Francisco Gomez
Rowlett, Texas, United States
    |     Who are we?     |     Contact
Copyright © 1999-2013 Engormix.com - All Rights Reserved